glp 1r Search Results


94
MedChemExpress glp 1r antagonist 1
Glp 1r Antagonist 1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP-1R+Antagonist+1/pmc13236593-49-1-11
Average 94 stars, based on 1 article reviews
glp 1r antagonist 1 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

92
OriGene pcmv6 glp1r myc ddk
Pcmv6 Glp1r Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP1R+(NM_002062)+Human+Tagged+ORF+Clone/pm28876923__ja7b05674_si_001-92-11-12
Average 92 stars, based on 1 article reviews
pcmv6 glp1r myc ddk - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

94
Santa Cruz Biotechnology glp 1r
Figure 1. <t>GLP-1R</t> expression at consecutive stages of lung maturation in male and female rats. (Upper panel) Representative RT-PCR assay of GLP-1R gene expression at different stages of lung development. (Lower panel) Semiquantitative values (%OD) represent the mean SEM of 5 independent determinations (n 5): *P .05, P1 vs fetal period (E18 or E20); $P .05, Ad vs E18 or E20; #P .05, P1 vs Ad; &P .05, male vs corresponding female group (Kruskal-Wallis test followed by multiple comparisons). The amplification of 18S and GLP- 1R was detected after 10 and 25 amplification cycles, respectively. MWM, molecular weight marker: 100-bp DNA ladder; N, negative C with no added cDNA. Ad, adult.
Glp 1r, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP-1R+Antibody/pm23354098-99-28-33
Average 94 stars, based on 1 article reviews
glp 1r - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

94
Proteintech glp1r
FIGURE 5 | Chronic effects of CLZ on hepatic <t>PGRMC1-EGFR/GLP1R</t> pathway and concentrations of PROG in plasma, liver and adrenal gland. (A) PGRMC1 (B) the ratio of p-EGFR/EGFR (C) GLP1R (D) PROG concentrations (ng/ml) in plasma (H = 12.53, p = 0.0138); (E) PROG concentrations (ng/g) in liver (H = 21.73, p = 0.0002); (F) PROG concentrations (ng/g) in adrenal gland (H = 20.15, p = 0.0005).
Glp1r, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP1R+Antibody/10__18314_slash_jnb__v4i2__1081-96-18-28
Average 94 stars, based on 1 article reviews
glp1r - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

92
OriGene human glp 1r cdna
FIGURE 5 | Chronic effects of CLZ on hepatic <t>PGRMC1-EGFR/GLP1R</t> pathway and concentrations of PROG in plasma, liver and adrenal gland. (A) PGRMC1 (B) the ratio of p-EGFR/EGFR (C) GLP1R (D) PROG concentrations (ng/ml) in plasma (H = 12.53, p = 0.0138); (E) PROG concentrations (ng/g) in liver (H = 21.73, p = 0.0002); (F) PROG concentrations (ng/g) in adrenal gland (H = 20.15, p = 0.0005).
Human Glp 1r Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP1R+(NM_002062)+Human+Untagged+Clone/pm28560433-43-0-6
Average 92 stars, based on 1 article reviews
human glp 1r cdna - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

95
MedChemExpress precursor dotanoc
FIGURE 5 | Chronic effects of CLZ on hepatic <t>PGRMC1-EGFR/GLP1R</t> pathway and concentrations of PROG in plasma, liver and adrenal gland. (A) PGRMC1 (B) the ratio of p-EGFR/EGFR (C) GLP1R (D) PROG concentrations (ng/ml) in plasma (H = 12.53, p = 0.0138); (E) PROG concentrations (ng/g) in liver (H = 21.73, p = 0.0002); (F) PROG concentrations (ng/g) in adrenal gland (H = 20.15, p = 0.0005).
Precursor Dotanoc, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP-1R+Antibody/pm36030760-50-1-20
Average 95 stars, based on 1 article reviews
precursor dotanoc - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

93
Novus Biologicals glp 1r antibody fitc
FIGURE 5 | Chronic effects of CLZ on hepatic <t>PGRMC1-EGFR/GLP1R</t> pathway and concentrations of PROG in plasma, liver and adrenal gland. (A) PGRMC1 (B) the ratio of p-EGFR/EGFR (C) GLP1R (D) PROG concentrations (ng/ml) in plasma (H = 12.53, p = 0.0138); (E) PROG concentrations (ng/g) in liver (H = 21.73, p = 0.0002); (F) PROG concentrations (ng/g) in adrenal gland (H = 20.15, p = 0.0005).
Glp 1r Antibody Fitc, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP-1R+Antibody+%5BFITC%5D/pm37854630-104-13-17
Average 93 stars, based on 1 article reviews
glp 1r antibody fitc - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
Novus Biologicals anti glp 1r
FIGURE 5 | Chronic effects of CLZ on hepatic <t>PGRMC1-EGFR/GLP1R</t> pathway and concentrations of PROG in plasma, liver and adrenal gland. (A) PGRMC1 (B) the ratio of p-EGFR/EGFR (C) GLP1R (D) PROG concentrations (ng/ml) in plasma (H = 12.53, p = 0.0138); (E) PROG concentrations (ng/g) in liver (H = 21.73, p = 0.0002); (F) PROG concentrations (ng/g) in adrenal gland (H = 20.15, p = 0.0005).
Anti Glp 1r, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP-1R+Antibody+-+BSA+Free/pmc06277380-84-13-16
Average 94 stars, based on 1 article reviews
anti glp 1r - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

93
Novus Biologicals rabbit polyclonal glp 1r antibody
FIGURE 5 | Chronic effects of CLZ on hepatic <t>PGRMC1-EGFR/GLP1R</t> pathway and concentrations of PROG in plasma, liver and adrenal gland. (A) PGRMC1 (B) the ratio of p-EGFR/EGFR (C) GLP1R (D) PROG concentrations (ng/ml) in plasma (H = 12.53, p = 0.0138); (E) PROG concentrations (ng/g) in liver (H = 21.73, p = 0.0002); (F) PROG concentrations (ng/g) in adrenal gland (H = 20.15, p = 0.0005).
Rabbit Polyclonal Glp 1r Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP-1R+Antibody+%5BPE%5D/pmc12181781-244-55-61
Average 93 stars, based on 1 article reviews
rabbit polyclonal glp 1r antibody - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
MedChemExpress s recombinant mouse glp 1r protein
Alleviating effects of UDCA on hepatic functions through expressing BSH. Images of liver tissue (A) H&E and (B) Oil Red O staining. Scale bar, 100 μm. n = 4 mice per group. (C) The NAFLD activity score (NAS) of the liver tissue. (D) Oil Red O-stained area. The mRNA levels of (E) FXR, (F) SHP, (G) SREBP-1c, (H) PPARα, (I) AMPK, (J) GRP78, (K) CYP7A1, (L) TNF- α , (M) IL-6, and (N) IL-10. n = 4 mice per group. (O, P) Representative fluorescent images of SHP/FXR and AMPK/p-AMPK. (Q) IHC images of <t>GLP-1R.</t> Scale bar, 100 μm. n = 4 mice per group. (R–U) Positive area of FXR, SHP, AMPK/p-AMPK and GLP-1R. (V) The flowchart of the BSH inhibitor treatment experiment. (W) Concentration of UDCA in the ileum. n = 3 mice per group. (X) Concentration of GLP-1 in the serum. n = 4 mice per group. Student’s t-test to evaluate differences between two groups. * p < 0.05; ** p < 0.01; *** p < 0.001, # p < 0.05 (UDCA_low vs. UDCA_high).
S Recombinant Mouse Glp 1r Protein, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP1R%2C+Mouse/pmc13166280-194-34-44
Average 94 stars, based on 1 article reviews
s recombinant mouse glp 1r protein - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
MedChemExpress glp 1r agonist
Alleviating effects of UDCA on hepatic functions through expressing BSH. Images of liver tissue (A) H&E and (B) Oil Red O staining. Scale bar, 100 μm. n = 4 mice per group. (C) The NAFLD activity score (NAS) of the liver tissue. (D) Oil Red O-stained area. The mRNA levels of (E) FXR, (F) SHP, (G) SREBP-1c, (H) PPARα, (I) AMPK, (J) GRP78, (K) CYP7A1, (L) TNF- α , (M) IL-6, and (N) IL-10. n = 4 mice per group. (O, P) Representative fluorescent images of SHP/FXR and AMPK/p-AMPK. (Q) IHC images of <t>GLP-1R.</t> Scale bar, 100 μm. n = 4 mice per group. (R–U) Positive area of FXR, SHP, AMPK/p-AMPK and GLP-1R. (V) The flowchart of the BSH inhibitor treatment experiment. (W) Concentration of UDCA in the ileum. n = 3 mice per group. (X) Concentration of GLP-1 in the serum. n = 4 mice per group. Student’s t-test to evaluate differences between two groups. * p < 0.05; ** p < 0.01; *** p < 0.001, # p < 0.05 (UDCA_low vs. UDCA_high).
Glp 1r Agonist, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP-1R+agonist+3/pm37353947-19-6-4
Average 91 stars, based on 1 article reviews
glp 1r agonist - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology ggcauugucaaguaucuc uacgagg antisense ccucguagagauacuugacaaugcc b glp 1r sirna 2 sense
Alleviating effects of UDCA on hepatic functions through expressing BSH. Images of liver tissue (A) H&E and (B) Oil Red O staining. Scale bar, 100 μm. n = 4 mice per group. (C) The NAFLD activity score (NAS) of the liver tissue. (D) Oil Red O-stained area. The mRNA levels of (E) FXR, (F) SHP, (G) SREBP-1c, (H) PPARα, (I) AMPK, (J) GRP78, (K) CYP7A1, (L) TNF- α , (M) IL-6, and (N) IL-10. n = 4 mice per group. (O, P) Representative fluorescent images of SHP/FXR and AMPK/p-AMPK. (Q) IHC images of <t>GLP-1R.</t> Scale bar, 100 μm. n = 4 mice per group. (R–U) Positive area of FXR, SHP, AMPK/p-AMPK and GLP-1R. (V) The flowchart of the BSH inhibitor treatment experiment. (W) Concentration of UDCA in the ileum. n = 3 mice per group. (X) Concentration of GLP-1 in the serum. n = 4 mice per group. Student’s t-test to evaluate differences between two groups. * p < 0.05; ** p < 0.01; *** p < 0.001, # p < 0.05 (UDCA_low vs. UDCA_high).
Ggcauugucaaguaucuc Uacgagg Antisense Ccucguagagauacuugacaaugcc B Glp 1r Sirna 2 Sense, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/glp+1r/GLP-1R+siRNA/pm35002615-74-12-43
Average 93 stars, based on 1 article reviews
ggcauugucaaguaucuc uacgagg antisense ccucguagagauacuugacaaugcc b glp 1r sirna 2 sense - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


Figure 1. GLP-1R expression at consecutive stages of lung maturation in male and female rats. (Upper panel) Representative RT-PCR assay of GLP-1R gene expression at different stages of lung development. (Lower panel) Semiquantitative values (%OD) represent the mean SEM of 5 independent determinations (n 5): *P .05, P1 vs fetal period (E18 or E20); $P .05, Ad vs E18 or E20; #P .05, P1 vs Ad; &P .05, male vs corresponding female group (Kruskal-Wallis test followed by multiple comparisons). The amplification of 18S and GLP- 1R was detected after 10 and 25 amplification cycles, respectively. MWM, molecular weight marker: 100-bp DNA ladder; N, negative C with no added cDNA. Ad, adult.

Journal: Endocrinology

Article Title: Pulmonary GLP-1 receptor increases at birth and exogenous GLP-1 receptor agonists augmented surfactant-protein levels in litters from normal and nitrofen-treated pregnant rats.

doi: 10.1210/en.2012-1786

Figure Lengend Snippet: Figure 1. GLP-1R expression at consecutive stages of lung maturation in male and female rats. (Upper panel) Representative RT-PCR assay of GLP-1R gene expression at different stages of lung development. (Lower panel) Semiquantitative values (%OD) represent the mean SEM of 5 independent determinations (n 5): *P .05, P1 vs fetal period (E18 or E20); $P .05, Ad vs E18 or E20; #P .05, P1 vs Ad; &P .05, male vs corresponding female group (Kruskal-Wallis test followed by multiple comparisons). The amplification of 18S and GLP- 1R was detected after 10 and 25 amplification cycles, respectively. MWM, molecular weight marker: 100-bp DNA ladder; N, negative C with no added cDNA. Ad, adult.

Article Snippet: Primary antibody binding was detected using the following horseradish peroxidase (HRP)-conjugated secondary antibodies: antigoat IgG-HRP for SP-A (1:10 000, sc-2020; Santa Cruz Biotechnology, Inc) and antirabbit IgG-HRP for GLP-1R and -actin (1:5000, sc-2004; Santa Cruz Biotechnology, Inc).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Gene Expression, Amplification, Molecular Weight, Marker

Figure 5. GLP-1R expression in lungs from C and NTF-treated fetuses. (Upper panel) Representative RT-PCR analysis of GLP-1R expression. (Lower panel) Semiquantitative values (%OD) are represented as the mean SEM of 5 independent determinations (n 5): *P .05 (Kruskal-Wallis test followed by multiple comparisons). The amplification of 18S and GLP-1R was detected after 10 and 25 PCR cycles, respectively. MWM, molecular weight marker: 100-bp DNA ladder; N, negative C with no added cDNA.

Journal: Endocrinology

Article Title: Pulmonary GLP-1 receptor increases at birth and exogenous GLP-1 receptor agonists augmented surfactant-protein levels in litters from normal and nitrofen-treated pregnant rats.

doi: 10.1210/en.2012-1786

Figure Lengend Snippet: Figure 5. GLP-1R expression in lungs from C and NTF-treated fetuses. (Upper panel) Representative RT-PCR analysis of GLP-1R expression. (Lower panel) Semiquantitative values (%OD) are represented as the mean SEM of 5 independent determinations (n 5): *P .05 (Kruskal-Wallis test followed by multiple comparisons). The amplification of 18S and GLP-1R was detected after 10 and 25 PCR cycles, respectively. MWM, molecular weight marker: 100-bp DNA ladder; N, negative C with no added cDNA.

Article Snippet: Primary antibody binding was detected using the following horseradish peroxidase (HRP)-conjugated secondary antibodies: antigoat IgG-HRP for SP-A (1:10 000, sc-2020; Santa Cruz Biotechnology, Inc) and antirabbit IgG-HRP for GLP-1R and -actin (1:5000, sc-2004; Santa Cruz Biotechnology, Inc).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Molecular Weight, Marker

FIGURE 5 | Chronic effects of CLZ on hepatic PGRMC1-EGFR/GLP1R pathway and concentrations of PROG in plasma, liver and adrenal gland. (A) PGRMC1 (B) the ratio of p-EGFR/EGFR (C) GLP1R (D) PROG concentrations (ng/ml) in plasma (H = 12.53, p = 0.0138); (E) PROG concentrations (ng/g) in liver (H = 21.73, p = 0.0002); (F) PROG concentrations (ng/g) in adrenal gland (H = 20.15, p = 0.0005).

Journal: Journal of Nutritional Biology

Article Title: Insulin Receptor Levels Regulated by the Receptor- Associated Protein Progesterone Receptor Membrane Component 1 (PGRMC1)

doi: 10.18314/jnb.v4i2.1081

Figure Lengend Snippet: FIGURE 5 | Chronic effects of CLZ on hepatic PGRMC1-EGFR/GLP1R pathway and concentrations of PROG in plasma, liver and adrenal gland. (A) PGRMC1 (B) the ratio of p-EGFR/EGFR (C) GLP1R (D) PROG concentrations (ng/ml) in plasma (H = 12.53, p = 0.0138); (E) PROG concentrations (ng/g) in liver (H = 21.73, p = 0.0002); (F) PROG concentrations (ng/g) in adrenal gland (H = 20.15, p = 0.0005).

Article Snippet: Approximately 20 mg of protein was loaded, electrophoresed, blotted and then incubated with primary antibodies against PGRMC1, EGFR, GLP1R, PI3K p85, Akt, phospho-Akt (Ser473), GSK-3b, FOXO1, b-actin, PCNA (Proteintech Group, Wuhan, China), phospho-EGFR, phospho-GSK-3b (Affinity) overnight at 4°C.

Techniques: Clinical Proteomics

FIGURE 6 | Illustrative model of the mechanism focusing on hepatic PGRMC1 signaling underlying chronic CLZ-induced hepatic glucose disturbances. The add-on PGRMC1-OE can reverse CLZ-induced hepatic glucose disturbances by upregulating the expression of PGRMC1-EGFR/GLP1R-PI3K-Akt-GSK3b accompanied with the downregulation of nuclear FOXO1. CLZ, CLZ; AG205, the specific inhibitor of PGRMC1; PGRMC1-KD, the knockdown of PGRMC1; PGRMC1-OE, the overexpression of PGRMC1; H&E, hematoxylin and eosin staining; PAS, Periodic acid–Schiff staining; PGRMC1, PROG receptor membrane component 1; EGFR, epidermal growth factor receptor; GLP1R, glucagon-like peptide-1 receptor; PI3K, 3-phosphoinositide-dependent kinase-1; Akt, protein kinase B; GSK3b, glycogen synthase kinase-3b; FOXO1, the fork head box protein 1.

Journal: Journal of Nutritional Biology

Article Title: Insulin Receptor Levels Regulated by the Receptor- Associated Protein Progesterone Receptor Membrane Component 1 (PGRMC1)

doi: 10.18314/jnb.v4i2.1081

Figure Lengend Snippet: FIGURE 6 | Illustrative model of the mechanism focusing on hepatic PGRMC1 signaling underlying chronic CLZ-induced hepatic glucose disturbances. The add-on PGRMC1-OE can reverse CLZ-induced hepatic glucose disturbances by upregulating the expression of PGRMC1-EGFR/GLP1R-PI3K-Akt-GSK3b accompanied with the downregulation of nuclear FOXO1. CLZ, CLZ; AG205, the specific inhibitor of PGRMC1; PGRMC1-KD, the knockdown of PGRMC1; PGRMC1-OE, the overexpression of PGRMC1; H&E, hematoxylin and eosin staining; PAS, Periodic acid–Schiff staining; PGRMC1, PROG receptor membrane component 1; EGFR, epidermal growth factor receptor; GLP1R, glucagon-like peptide-1 receptor; PI3K, 3-phosphoinositide-dependent kinase-1; Akt, protein kinase B; GSK3b, glycogen synthase kinase-3b; FOXO1, the fork head box protein 1.

Article Snippet: Approximately 20 mg of protein was loaded, electrophoresed, blotted and then incubated with primary antibodies against PGRMC1, EGFR, GLP1R, PI3K p85, Akt, phospho-Akt (Ser473), GSK-3b, FOXO1, b-actin, PCNA (Proteintech Group, Wuhan, China), phospho-EGFR, phospho-GSK-3b (Affinity) overnight at 4°C.

Techniques: Expressing, Knockdown, Over Expression, Staining, Membrane

Alleviating effects of UDCA on hepatic functions through expressing BSH. Images of liver tissue (A) H&E and (B) Oil Red O staining. Scale bar, 100 μm. n = 4 mice per group. (C) The NAFLD activity score (NAS) of the liver tissue. (D) Oil Red O-stained area. The mRNA levels of (E) FXR, (F) SHP, (G) SREBP-1c, (H) PPARα, (I) AMPK, (J) GRP78, (K) CYP7A1, (L) TNF- α , (M) IL-6, and (N) IL-10. n = 4 mice per group. (O, P) Representative fluorescent images of SHP/FXR and AMPK/p-AMPK. (Q) IHC images of GLP-1R. Scale bar, 100 μm. n = 4 mice per group. (R–U) Positive area of FXR, SHP, AMPK/p-AMPK and GLP-1R. (V) The flowchart of the BSH inhibitor treatment experiment. (W) Concentration of UDCA in the ileum. n = 3 mice per group. (X) Concentration of GLP-1 in the serum. n = 4 mice per group. Student’s t-test to evaluate differences between two groups. * p < 0.05; ** p < 0.01; *** p < 0.001, # p < 0.05 (UDCA_low vs. UDCA_high).

Journal: Gut Microbes

Article Title: A novel bile salt hydrolase-producing Ligilactobacillus salivarius prevents diet-induced obesity via regulation of bile acid metabolism and glucagon-like peptide 1 restoration

doi: 10.1080/19490976.2026.2668127

Figure Lengend Snippet: Alleviating effects of UDCA on hepatic functions through expressing BSH. Images of liver tissue (A) H&E and (B) Oil Red O staining. Scale bar, 100 μm. n = 4 mice per group. (C) The NAFLD activity score (NAS) of the liver tissue. (D) Oil Red O-stained area. The mRNA levels of (E) FXR, (F) SHP, (G) SREBP-1c, (H) PPARα, (I) AMPK, (J) GRP78, (K) CYP7A1, (L) TNF- α , (M) IL-6, and (N) IL-10. n = 4 mice per group. (O, P) Representative fluorescent images of SHP/FXR and AMPK/p-AMPK. (Q) IHC images of GLP-1R. Scale bar, 100 μm. n = 4 mice per group. (R–U) Positive area of FXR, SHP, AMPK/p-AMPK and GLP-1R. (V) The flowchart of the BSH inhibitor treatment experiment. (W) Concentration of UDCA in the ileum. n = 3 mice per group. (X) Concentration of GLP-1 in the serum. n = 4 mice per group. Student’s t-test to evaluate differences between two groups. * p < 0.05; ** p < 0.01; *** p < 0.001, # p < 0.05 (UDCA_low vs. UDCA_high).

Article Snippet: The sensor surface was activated by injecting a freshly prepared 1:1 mixture of 400 mM N -ethyl-N’-(3-dimethylaminopropyl) carbodiimide (EDC) and 100 mM N -hydroxysuccinimide (NHS) at a flow rate of 10 μL/min for 420 s. Recombinant mouse GLP-1R protein (Catalog No. HY- P72206 , MedChemExpress) was diluted in 10 mM sodium acetate buffer (pH 4.5) to a concentration of 20 μg/mL and then immobilized onto the sample channel (Fc2) at 10 μL/min, achieving an immobilization level of approximately 12,600 response units (RU).

Techniques: Expressing, Staining, Activity Assay, Concentration Assay

UDCA reverses abnormalities in bile acid metabolism and dyslipidemia in glucose-treated HepG2 cells. (A) The viability of HepG2 cells treated with high glucose after different interventions. The mRNA levels of (B) FXR, (C) SHP, (D) SREBP-1c, (E) PPARα, (F) AMPK, (G) GRP78, and (H) CYP7A1. (I) Oil Red O-stained slices of HepG2 cells are shown. Scale bar, 50 μm. n = 4 mice per group. (J) Quantitative analyses of Oil Red O-stained slices of HepG2 cells are shown. (K) Representative fluorescent images of AMPK/p-AMPK. Scale bar, 100 μm. n = 4 mice per group. (L) Positive area of AMPK/p-AMPK. (M) Immunofluorescence staining of GLP-1R in HepG2 cells. Scale bar, 50 μm. n = 4 mice per group. (N) Positive area of GLP-1R. Molecular docking results of the (O) mouse and (P) human complexes over 200 ns MD simulations. Gibbs free energy of the (Q) mice and (R) humans. (S) Surface plasmon resonance (SPR) kinetic sensorgrams of UDCA binding to immobilized GLP-1R. (T) Steady-state affinity fitting curve. (U) Concentration of cAMP in HepG2 cells. n = 4 mice per group. Student’s t-test is used to evaluate differences between two groups. * p < 0.05; ** p < 0.01; *** p < 0.001, # p < 0.05 (UDCA_50. vs. UDCA_100; UDCA_200. vs. UDCA_100).

Journal: Gut Microbes

Article Title: A novel bile salt hydrolase-producing Ligilactobacillus salivarius prevents diet-induced obesity via regulation of bile acid metabolism and glucagon-like peptide 1 restoration

doi: 10.1080/19490976.2026.2668127

Figure Lengend Snippet: UDCA reverses abnormalities in bile acid metabolism and dyslipidemia in glucose-treated HepG2 cells. (A) The viability of HepG2 cells treated with high glucose after different interventions. The mRNA levels of (B) FXR, (C) SHP, (D) SREBP-1c, (E) PPARα, (F) AMPK, (G) GRP78, and (H) CYP7A1. (I) Oil Red O-stained slices of HepG2 cells are shown. Scale bar, 50 μm. n = 4 mice per group. (J) Quantitative analyses of Oil Red O-stained slices of HepG2 cells are shown. (K) Representative fluorescent images of AMPK/p-AMPK. Scale bar, 100 μm. n = 4 mice per group. (L) Positive area of AMPK/p-AMPK. (M) Immunofluorescence staining of GLP-1R in HepG2 cells. Scale bar, 50 μm. n = 4 mice per group. (N) Positive area of GLP-1R. Molecular docking results of the (O) mouse and (P) human complexes over 200 ns MD simulations. Gibbs free energy of the (Q) mice and (R) humans. (S) Surface plasmon resonance (SPR) kinetic sensorgrams of UDCA binding to immobilized GLP-1R. (T) Steady-state affinity fitting curve. (U) Concentration of cAMP in HepG2 cells. n = 4 mice per group. Student’s t-test is used to evaluate differences between two groups. * p < 0.05; ** p < 0.01; *** p < 0.001, # p < 0.05 (UDCA_50. vs. UDCA_100; UDCA_200. vs. UDCA_100).

Article Snippet: The sensor surface was activated by injecting a freshly prepared 1:1 mixture of 400 mM N -ethyl-N’-(3-dimethylaminopropyl) carbodiimide (EDC) and 100 mM N -hydroxysuccinimide (NHS) at a flow rate of 10 μL/min for 420 s. Recombinant mouse GLP-1R protein (Catalog No. HY- P72206 , MedChemExpress) was diluted in 10 mM sodium acetate buffer (pH 4.5) to a concentration of 20 μg/mL and then immobilized onto the sample channel (Fc2) at 10 μL/min, achieving an immobilization level of approximately 12,600 response units (RU).

Techniques: Staining, Immunofluorescence, SPR Assay, Binding Assay, Concentration Assay