|
MedChemExpress
glp 1r antagonist 1 Glp 1r Antagonist 1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP-1R+Antagonist+1/pmc13236593-49-1-11 Average 94 stars, based on 1 article reviews
glp 1r antagonist 1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
pcmv6 glp1r myc ddk Pcmv6 Glp1r Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP1R+(NM_002062)+Human+Tagged+ORF+Clone/pm28876923__ja7b05674_si_001-92-11-12 Average 92 stars, based on 1 article reviews
pcmv6 glp1r myc ddk - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
glp 1r ![]() Glp 1r, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP-1R+Antibody/pm23354098-99-28-33 Average 94 stars, based on 1 article reviews
glp 1r - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Proteintech
glp1r ![]() Glp1r, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP1R+Antibody/10__18314_slash_jnb__v4i2__1081-96-18-28 Average 94 stars, based on 1 article reviews
glp1r - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
OriGene
human glp 1r cdna ![]() Human Glp 1r Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP1R+(NM_002062)+Human+Untagged+Clone/pm28560433-43-0-6 Average 92 stars, based on 1 article reviews
human glp 1r cdna - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
MedChemExpress
precursor dotanoc ![]() Precursor Dotanoc, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP-1R+Antibody/pm36030760-50-1-20 Average 95 stars, based on 1 article reviews
precursor dotanoc - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
Novus Biologicals
glp 1r antibody fitc ![]() Glp 1r Antibody Fitc, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP-1R+Antibody+%5BFITC%5D/pm37854630-104-13-17 Average 93 stars, based on 1 article reviews
glp 1r antibody fitc - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Novus Biologicals
anti glp 1r ![]() Anti Glp 1r, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP-1R+Antibody+-+BSA+Free/pmc06277380-84-13-16 Average 94 stars, based on 1 article reviews
anti glp 1r - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Novus Biologicals
rabbit polyclonal glp 1r antibody ![]() Rabbit Polyclonal Glp 1r Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP-1R+Antibody+%5BPE%5D/pmc12181781-244-55-61 Average 93 stars, based on 1 article reviews
rabbit polyclonal glp 1r antibody - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
MedChemExpress
s recombinant mouse glp 1r protein ![]() S Recombinant Mouse Glp 1r Protein, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP1R%2C+Mouse/pmc13166280-194-34-44 Average 94 stars, based on 1 article reviews
s recombinant mouse glp 1r protein - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
MedChemExpress
glp 1r agonist ![]() Glp 1r Agonist, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP-1R+agonist+3/pm37353947-19-6-4 Average 91 stars, based on 1 article reviews
glp 1r agonist - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
ggcauugucaaguaucuc uacgagg antisense ccucguagagauacuugacaaugcc b glp 1r sirna 2 sense ![]() Ggcauugucaaguaucuc Uacgagg Antisense Ccucguagagauacuugacaaugcc B Glp 1r Sirna 2 Sense, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/glp+1r/GLP-1R+siRNA/pm35002615-74-12-43 Average 93 stars, based on 1 article reviews
ggcauugucaaguaucuc uacgagg antisense ccucguagagauacuugacaaugcc b glp 1r sirna 2 sense - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Endocrinology
Article Title: Pulmonary GLP-1 receptor increases at birth and exogenous GLP-1 receptor agonists augmented surfactant-protein levels in litters from normal and nitrofen-treated pregnant rats.
doi: 10.1210/en.2012-1786
Figure Lengend Snippet: Figure 1. GLP-1R expression at consecutive stages of lung maturation in male and female rats. (Upper panel) Representative RT-PCR assay of GLP-1R gene expression at different stages of lung development. (Lower panel) Semiquantitative values (%OD) represent the mean SEM of 5 independent determinations (n 5): *P .05, P1 vs fetal period (E18 or E20); $P .05, Ad vs E18 or E20; #P .05, P1 vs Ad; &P .05, male vs corresponding female group (Kruskal-Wallis test followed by multiple comparisons). The amplification of 18S and GLP- 1R was detected after 10 and 25 amplification cycles, respectively. MWM, molecular weight marker: 100-bp DNA ladder; N, negative C with no added cDNA. Ad, adult.
Article Snippet: Primary antibody binding was detected using the following horseradish peroxidase (HRP)-conjugated secondary antibodies: antigoat IgG-HRP for SP-A (1:10 000, sc-2020; Santa Cruz Biotechnology, Inc) and antirabbit IgG-HRP for
Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Gene Expression, Amplification, Molecular Weight, Marker
Journal: Endocrinology
Article Title: Pulmonary GLP-1 receptor increases at birth and exogenous GLP-1 receptor agonists augmented surfactant-protein levels in litters from normal and nitrofen-treated pregnant rats.
doi: 10.1210/en.2012-1786
Figure Lengend Snippet: Figure 5. GLP-1R expression in lungs from C and NTF-treated fetuses. (Upper panel) Representative RT-PCR analysis of GLP-1R expression. (Lower panel) Semiquantitative values (%OD) are represented as the mean SEM of 5 independent determinations (n 5): *P .05 (Kruskal-Wallis test followed by multiple comparisons). The amplification of 18S and GLP-1R was detected after 10 and 25 PCR cycles, respectively. MWM, molecular weight marker: 100-bp DNA ladder; N, negative C with no added cDNA.
Article Snippet: Primary antibody binding was detected using the following horseradish peroxidase (HRP)-conjugated secondary antibodies: antigoat IgG-HRP for SP-A (1:10 000, sc-2020; Santa Cruz Biotechnology, Inc) and antirabbit IgG-HRP for
Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Molecular Weight, Marker
Journal: Journal of Nutritional Biology
Article Title: Insulin Receptor Levels Regulated by the Receptor- Associated Protein Progesterone Receptor Membrane Component 1 (PGRMC1)
doi: 10.18314/jnb.v4i2.1081
Figure Lengend Snippet: FIGURE 5 | Chronic effects of CLZ on hepatic PGRMC1-EGFR/GLP1R pathway and concentrations of PROG in plasma, liver and adrenal gland. (A) PGRMC1 (B) the ratio of p-EGFR/EGFR (C) GLP1R (D) PROG concentrations (ng/ml) in plasma (H = 12.53, p = 0.0138); (E) PROG concentrations (ng/g) in liver (H = 21.73, p = 0.0002); (F) PROG concentrations (ng/g) in adrenal gland (H = 20.15, p = 0.0005).
Article Snippet: Approximately 20 mg of protein was loaded, electrophoresed, blotted and then incubated with primary antibodies against PGRMC1, EGFR,
Techniques: Clinical Proteomics
Journal: Journal of Nutritional Biology
Article Title: Insulin Receptor Levels Regulated by the Receptor- Associated Protein Progesterone Receptor Membrane Component 1 (PGRMC1)
doi: 10.18314/jnb.v4i2.1081
Figure Lengend Snippet: FIGURE 6 | Illustrative model of the mechanism focusing on hepatic PGRMC1 signaling underlying chronic CLZ-induced hepatic glucose disturbances. The add-on PGRMC1-OE can reverse CLZ-induced hepatic glucose disturbances by upregulating the expression of PGRMC1-EGFR/GLP1R-PI3K-Akt-GSK3b accompanied with the downregulation of nuclear FOXO1. CLZ, CLZ; AG205, the specific inhibitor of PGRMC1; PGRMC1-KD, the knockdown of PGRMC1; PGRMC1-OE, the overexpression of PGRMC1; H&E, hematoxylin and eosin staining; PAS, Periodic acid–Schiff staining; PGRMC1, PROG receptor membrane component 1; EGFR, epidermal growth factor receptor; GLP1R, glucagon-like peptide-1 receptor; PI3K, 3-phosphoinositide-dependent kinase-1; Akt, protein kinase B; GSK3b, glycogen synthase kinase-3b; FOXO1, the fork head box protein 1.
Article Snippet: Approximately 20 mg of protein was loaded, electrophoresed, blotted and then incubated with primary antibodies against PGRMC1, EGFR,
Techniques: Expressing, Knockdown, Over Expression, Staining, Membrane
Journal: Gut Microbes
Article Title: A novel bile salt hydrolase-producing Ligilactobacillus salivarius prevents diet-induced obesity via regulation of bile acid metabolism and glucagon-like peptide 1 restoration
doi: 10.1080/19490976.2026.2668127
Figure Lengend Snippet: Alleviating effects of UDCA on hepatic functions through expressing BSH. Images of liver tissue (A) H&E and (B) Oil Red O staining. Scale bar, 100 μm. n = 4 mice per group. (C) The NAFLD activity score (NAS) of the liver tissue. (D) Oil Red O-stained area. The mRNA levels of (E) FXR, (F) SHP, (G) SREBP-1c, (H) PPARα, (I) AMPK, (J) GRP78, (K) CYP7A1, (L) TNF- α , (M) IL-6, and (N) IL-10. n = 4 mice per group. (O, P) Representative fluorescent images of SHP/FXR and AMPK/p-AMPK. (Q) IHC images of GLP-1R. Scale bar, 100 μm. n = 4 mice per group. (R–U) Positive area of FXR, SHP, AMPK/p-AMPK and GLP-1R. (V) The flowchart of the BSH inhibitor treatment experiment. (W) Concentration of UDCA in the ileum. n = 3 mice per group. (X) Concentration of GLP-1 in the serum. n = 4 mice per group. Student’s t-test to evaluate differences between two groups. * p < 0.05; ** p < 0.01; *** p < 0.001, # p < 0.05 (UDCA_low vs. UDCA_high).
Article Snippet: The sensor surface was activated by injecting a freshly prepared 1:1 mixture of 400 mM N -ethyl-N’-(3-dimethylaminopropyl) carbodiimide (EDC) and 100 mM N -hydroxysuccinimide (NHS) at a flow rate of 10 μL/min for 420
Techniques: Expressing, Staining, Activity Assay, Concentration Assay
Journal: Gut Microbes
Article Title: A novel bile salt hydrolase-producing Ligilactobacillus salivarius prevents diet-induced obesity via regulation of bile acid metabolism and glucagon-like peptide 1 restoration
doi: 10.1080/19490976.2026.2668127
Figure Lengend Snippet: UDCA reverses abnormalities in bile acid metabolism and dyslipidemia in glucose-treated HepG2 cells. (A) The viability of HepG2 cells treated with high glucose after different interventions. The mRNA levels of (B) FXR, (C) SHP, (D) SREBP-1c, (E) PPARα, (F) AMPK, (G) GRP78, and (H) CYP7A1. (I) Oil Red O-stained slices of HepG2 cells are shown. Scale bar, 50 μm. n = 4 mice per group. (J) Quantitative analyses of Oil Red O-stained slices of HepG2 cells are shown. (K) Representative fluorescent images of AMPK/p-AMPK. Scale bar, 100 μm. n = 4 mice per group. (L) Positive area of AMPK/p-AMPK. (M) Immunofluorescence staining of GLP-1R in HepG2 cells. Scale bar, 50 μm. n = 4 mice per group. (N) Positive area of GLP-1R. Molecular docking results of the (O) mouse and (P) human complexes over 200 ns MD simulations. Gibbs free energy of the (Q) mice and (R) humans. (S) Surface plasmon resonance (SPR) kinetic sensorgrams of UDCA binding to immobilized GLP-1R. (T) Steady-state affinity fitting curve. (U) Concentration of cAMP in HepG2 cells. n = 4 mice per group. Student’s t-test is used to evaluate differences between two groups. * p < 0.05; ** p < 0.01; *** p < 0.001, # p < 0.05 (UDCA_50. vs. UDCA_100; UDCA_200. vs. UDCA_100).
Article Snippet: The sensor surface was activated by injecting a freshly prepared 1:1 mixture of 400 mM N -ethyl-N’-(3-dimethylaminopropyl) carbodiimide (EDC) and 100 mM N -hydroxysuccinimide (NHS) at a flow rate of 10 μL/min for 420
Techniques: Staining, Immunofluorescence, SPR Assay, Binding Assay, Concentration Assay